Review



superscript iv vilo mastermix with ezdnase kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher superscript iv vilo mastermix with ezdnase kit
    Superscript Iv Vilo Mastermix With Ezdnase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iv+vilo+mastermix+ezdnase+kit/superscript+iv+vilo+master+mix+with+ezdnase+enzyme/pm38971156-730-16-18
    Average 90 stars, based on 1 article reviews
    superscript iv vilo mastermix with ezdnase kit - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: A second hotspot for pathogenic exon-skipping variants in CDC45.
    Article Snippet: HEK293FT cells were transfected with the constructed plasmids using Lipofectamine-2000 (Invitrogen). .. After 24 h, RNA was extracted using Qiagen RNeasy Mini kit (Qiagen) and cDNA synthesized using SuperScript IV VILO Mastermix with ezDNase kit (Invitrogen). .. Plasmidspecific oligonucleotides (sense: CCTGCTCATCCTCTGGGAGC and anti-sense: AGGTCTGAAGGTCACGGGCC) were used in an RT-PCR using Phusion Flash II polymerase mastermix (Thermo) (denaturation 98 °C for 30 s, annealing 67 °C for 10 s, extension 72 °C for 1 min, for 21 cycles), and products were visualized by agarose gel electrophoresis.



    Similar Products

    90
    Thermo Fisher superscript iv vilo mastermix with ezdnase kit
    Superscript Iv Vilo Mastermix With Ezdnase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iv+vilo+mastermix+ezdnase+kit/superscript+iv+vilo+master+mix+with+ezdnase+enzyme/pm38971156-730-16-18
    Average 90 stars, based on 1 article reviews
    superscript iv vilo mastermix with ezdnase kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript iv vilo mastermix ezdnase kit
    Superscript Iv Vilo Mastermix Ezdnase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iv+vilo+mastermix+ezdnase+kit/pm38467731-54-21-23
    Average 90 stars, based on 1 article reviews
    superscript iv vilo mastermix ezdnase kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results